shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(PIGX-shRNA-Seq1)(CAT#: AdV-SI2047WQ)

This product is a PIGX-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The PIGX gene encodes a type I transmembrane protein in the endoplasmic reticulum (ER) and the protein is an essential component of glycosylphosphatidylinositol-mannosyltransferase I. The expression of PIGX-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert PIGX-shRNA-Seq1
Related Target/Protein PIGX
Region CDS
TargetSeq GAAGCCTCGATTGTGGTCAAT
NCBI RefSeq NM_017861
Alternative Names PIG-X
Titer >1*10^10 GC/mL
Target Gene
Gene ID 54965
Uniprot ID Q8TBF5

Related Products