shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(1500015O10Rik-shRNA-Seq1)(CAT#: AdV-SI2236WQ)

This product is a 1500015O10Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The products of 1500015O10Rik gene is probable hormone that may attenuate cell proliferation and induce senescence of oligodendrocyte and neural precursor cells in the central nervous system. The expression of 1500015O10Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert 1500015O10Rik-shRNA-Seq1
Related Target/Protein 1500015O10Rik
Region CDS
TargetSeq CCGAGAACACAGCAAAGGAAT
NCBI RefSeq NM_024283
Alternative Names Ecrg4
Titer >1*10^10 GC/mL
Related Diseases Nervous system disease
Target Gene
Gene ID 78896
Uniprot ID Q99LS0

Related Products