shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(2510003E04Rik-shRNA-Seq1)(CAT#: AdV-SI2219WQ)

This product is a 2510003E04Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of 2510003E04Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert 2510003E04Rik-shRNA-Seq1
Related Target/Protein 2510003E04Rik
Region 3UTR
TargetSeq CCTAATTATGTAAGTTGCCTT
NCBI RefSeq NM_028197
Alternative Names KBP; mKIAA1279; 0710007C18Rik; Kif1bp
Titer >1*10^10 GC/mL
Target Gene
Gene ID 72320
Uniprot ID H3BIY2

Related Products