shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Tbc1d22b-shRNA-Seq1)(CAT#: AdV-SI4020WQ)

This product is a Tbc1d22b-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Tbc1d22b gene may act as a GTPase-activating protein for Rab family protein. The expression of Tbc1d22b-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Tbc1d22b-shRNA-Seq1
Related Target/Protein Tbc1d22b
Region 3UTR
TargetSeq CGAGTATGTGTGTGTGTGTAT
NCBI RefSeq NM_198647
Alternative Names C6orf197
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55633
Uniprot ID Q9NU19

Related Products