shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(BEST1-shRNA-Seq1)(CAT#: AdV-SI0235WQ)

This product is a BEST1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The BEST1 gene encodes a member of the bestrophin gene family. This small gene family is characterized by proteins with a highly conserved N-terminus with four to six transmembrane domains. The expression of BEST1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert BEST1-shRNA-Seq1
Related Target/Protein BEST1
Region CDS
TargetSeq GACTCTGTATTGCGACAGCTA
NCBI RefSeq NM_004183
Alternative Names ARB; BMD; BEST; RP50; VMD2; TU15B; Best1V1Delta2
Titer >1*10^10 GC/mL
Related Diseases Macular Dystrophy
Target Gene
Gene ID 7439
Uniprot ID O76090

Related Products