shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(C11orf76-shRNA-Seq1)(CAT#: AdV-SI0224WQ)

This product is a C11orf76-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of C11orf76-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C11orf76-shRNA-Seq1
Related Target/Protein C11orf76
Region CDS
TargetSeq GAAGAAACCGAGTGAGGATGA
NCBI RefSeq NM_145308
Alternative Names SHANK2-AS3
Titer >1*10^10 GC/mL
Target Gene
Gene ID 220070
Uniprot ID Q9BTD1

Related Products