shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(C3orf15-shRNA-Seq3)(CAT#: AdV-SI0460WQ)

Datasheet

This product is a C3orf15-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C3orf15 gene may play a role in spermatogenesis and regulate cilium motility through its role in the assembly of the axonemal radial spokes. The expression of C3orf15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C3orf15-shRNA-Seq3
Related Target/Protein C3orf15
Region 3UTR
TargetSeq CCAGTAAGGAAGCAACTAAAT
NCBI RefSeq NM_033364
Alternative Names AAT1; CFAP91; MAATS1; CaM-IP2; SPATA26; AAT1alpha
Titer >1*10^10 GC/mL
Related Diseases Kartagener syndrome
Target Gene
Gene ID 89876
Uniprot ID Q7Z4T9

Related Products

Recombinant adenovirus, pU6-(Mouse TAB2 3'UTR), Overexpression (CAT#:AdV-GTOH0735WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Med18-shRNA-Seq2) (CAT#:AdV-SI1879WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(1700120K04Rik-shRNA-Seq1) (CAT#:AdV-SI3197WQ) Recombinant adenovirus, pU6-(Human hsa-mir-200a), Overexpression (CAT#:AdV-GTOH0244WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(THOC1-shRNA-Seq2) (CAT#:AdV-SI0531WQ) Recombinant adenovirus, pU6-(Human PRKCD), Overexpression (CAT#:AdV-GTOH0820WQ) Recombinant adenovirus, pU6-(Human VEGF-B 167), Overexpression (CAT#:AdV-GTOH0099WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Olfr1462-shRNA-Seq3) (CAT#:AdV-SI3774WQ)