shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(LOC154872-shRNA-Seq3)(CAT#: AdV-SI0265WQ)

This product is a LOC154872-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of LOC154872-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert LOC154872-shRNA-Seq3
Related Target/Protein LOC154872
Region CDS
TargetSeq CAGAAATCTACTCTTTGACAA
NCBI RefSeq NM_001024603
Alternative Names C7orf77
Titer >1*10^10 GC/mL
Target Gene
Gene ID 154872
Uniprot ID A4D0Y5

Related Products