shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(DZIP1L-shRNA-Seq2)(CAT#: AdV-SI0637WQ)
This product is a DZIP1L-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The DZIP1L gene encoded proterin is involved in primary cilium formation. Probably acts as a transition zone protein required for localization of PKD1/PC1 and PKD2/PC2 to the ciliary membrane. The expression of DZIP1L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | DZIP1L-shRNA-Seq2 |
Related Target/Protein | DZIP1L |
Region | CDS |
TargetSeq | CCAGTGGAAGAGGTGTTAGAA |
NCBI RefSeq | NM_173543 |
Alternative Names | PKD5; DZIP2 |
Titer | >1*10^10 GC/mL |
Related Diseases | Testis cancer |