shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(LRRC47-shRNA-Seq2)(CAT#: AdV-SI0446WQ)
This product is a LRRC47-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The LRRC47 gene encodes a protein that significantly changed phosphorylation state in response to short-term vasopressin treatment. The expression of LRRC47-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | LRRC47-shRNA-Seq2 |
| Related Target/Protein | LRRC47 |
| Region | CDS |
| TargetSeq | CCCACCAATAACCAACAGTGA |
| NCBI RefSeq | NM_020710 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Short-term vasopressin |
