shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Mrpl14-shRNA-Seq1)(CAT#: AdV-SI2342WQ)
This product is a Mrpl14-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Mrpl14 gene encodes a protein component of the 39S subunit of the mitochondrial ribosome. The expression of Mrpl14-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Mrpl14-shRNA-Seq1 |
Related Target/Protein | Mrpl14 |
Region | CDS |
TargetSeq | CCTCATTGAGGACAATGGCAA |
NCBI RefSeq | NM_026732 |
Alternative Names | L14mt; L32mt; MRPL32; RMPL32; RPML32; MRP-L14; MRP-L32 |
Titer | >1*10^10 GC/mL |