shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(OR13F1-shRNA-Seq3)(CAT#: AdV-SI1641WQ)

This product is a OR13F1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The OR13F1 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR13F1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert OR13F1-shRNA-Seq3
Related Target/Protein OR13F1
Region CDS
TargetSeq CCCATGCCAATGCTACTCATT
NCBI RefSeq XM_071099
Alternative Names OR9-6
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 138805
Uniprot ID Q8NGS4

Related Products