shRNA Lentivirus (self-inactivating), p7SK-(4930447C04Rik-shRNA-Seq2)(CAT#: LV-SI3563WQ)

This product is a 4930447C04Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 4930447C04Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 4930447C04Rik-shRNA-Seq2
Related Target/Protein 4930447C04Rik
Region CDS
TargetSeq GACTCTGGTATGGATAGTAAT
NCBI RefSeq NM_029444
Alternative Names Six6OS; Six6as; Six6os1; 4921504I02Rik; A930035O15Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 75801
Uniprot ID B2RQE0

Related Products