shRNA Lentivirus (self-inactivating), p7SK-(4930447C04Rik-shRNA-Seq3)(CAT#: LV-SI3564WQ)

Datasheet

This product is a 4930447C04Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 4930447C04Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 4930447C04Rik-shRNA-Seq3
Related Target/Protein 4930447C04Rik
Region CDS
TargetSeq GGACATTATACGTAGTTAATT
NCBI RefSeq NM_029444
Alternative Names Six6OS; Six6as; Six6os1; 4921504I02Rik; A930035O15Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 75801
Uniprot ID B2RQE0

Related Products

Recombinant lentivirus, pU6-(Human SCARB1), Overexpression (CAT#:Lenti-GTOH0417WQ) Recombinant lentivirus, pU6-(Mouse Ptpn1(NGF)), Overexpression (CAT#:Lenti-GTOH0286WQ) shRNA Lentivirus (self-inactivating), pH1-(PGBD4-shRNA-Seq2) (CAT#:LV-SI0591WQ) shRNA Lentivirus (self-inactivating), pH1-(LOC154872-shRNA-Seq2) (CAT#:LV-SI0765WQ) shRNA Lentivirus (self-inactivating), pH1-(Lypd1-shRNA-Seq1) (CAT#:LV-SI3126WQ) Recombinant lentivirus, pU6-(Human SIGMAR1), Overexpression (CAT#:Lenti-GTOH0273WQ) Recombinant lentivirus, pU6-(Human BCL2L11), Overexpression (CAT#:Lenti-GTOH0673WQ) shRNA Lentivirus (self-inactivating), pU6-(CCDC67-shRNA-Seq3) (CAT#:LV-SI0196WQ)