shRNA Lentivirus (self-inactivating), p7SK-(4932416K20Rik-shRNA-Seq1)(CAT#: LV-SI4022WQ)

This product is a 4932416K20Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 4932416K20Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 4932416K20Rik-shRNA-Seq1
Related Target/Protein 4932416K20Rik
Region CDS
TargetSeq CAAACGCAACCGTGTCCATTA
NCBI RefSeq NM_001002775
Titer >1*10^10 GC/mL
Target Gene
Gene ID 442809
Uniprot ID Q8CDH3

Related Products