shRNA Lentivirus (self-inactivating), p7SK-(LRRC18-shRNA-Seq3)(CAT#: LV-SI1210WQ)

This product is a LRRC18-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The LRRC18 gene may be involved in the regulation of spermatogenesis and sperm maturation. The expression of LRRC18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert LRRC18-shRNA-Seq3
Related Target/Protein LRRC18
Region CDS
TargetSeq GCTGAAGCAACTCAAGAACAT
NCBI RefSeq NM_001006939
Alternative Names UNQ933; UNQ9338; VKGE9338
Titer >1*10^10 GC/mL
Target Gene
Gene ID 474354
Uniprot ID Q8N456

Related Products