shRNA Lentivirus (self-inactivating), p7SK-(LRRC18-shRNA-Seq3)(CAT#: LV-SI1210WQ)
This product is a LRRC18-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The LRRC18 gene may be involved in the regulation of spermatogenesis and sperm maturation. The expression of LRRC18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | LRRC18-shRNA-Seq3 |
Related Target/Protein | LRRC18 |
Region | CDS |
TargetSeq | GCTGAAGCAACTCAAGAACAT |
NCBI RefSeq | NM_001006939 |
Alternative Names | UNQ933; UNQ9338; VKGE9338 |
Titer | >1*10^10 GC/mL |