shRNA Lentivirus (self-inactivating), p7SK-(Armc5-shRNA-Seq1)(CAT#: LV-SI4034WQ)

This product is a Armc5-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Armc5 gene encodes a member of the ARM (armadillo/beta-catenin-like repeat) superfamily. Mutations in this gene are associated with primary bilateral macronodular adrenal hyperplasia, which is also known as ACTH-independent macronodular adrenal hyperplasia 2. The expression of Armc5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Armc5-shRNA-Seq1
Related Target/Protein Armc5
Region 3UTR
TargetSeq CCAGGATGAAGATCTAACGAT
NCBI RefSeq NM_146205
Alternative Names AIMAH2
Titer >1*10^10 GC/mL
Related Diseases ACTH-independent macronodular adrenal hyperplasia 2
Target Gene
Gene ID 79798
Uniprot ID Q96C12

Related Products