shRNA Lentivirus (self-inactivating), p7SK-(Armc5-shRNA-Seq1)(CAT#: LV-SI4034WQ)
This product is a Armc5-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Armc5 gene encodes a member of the ARM (armadillo/beta-catenin-like repeat) superfamily. Mutations in this gene are associated with primary bilateral macronodular adrenal hyperplasia, which is also known as ACTH-independent macronodular adrenal hyperplasia 2. The expression of Armc5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Armc5-shRNA-Seq1 |
Related Target/Protein | Armc5 |
Region | 3UTR |
TargetSeq | CCAGGATGAAGATCTAACGAT |
NCBI RefSeq | NM_146205 |
Alternative Names | AIMAH2 |
Titer | >1*10^10 GC/mL |
Related Diseases | ACTH-independent macronodular adrenal hyperplasia 2 |