shRNA Lentivirus (self-inactivating), p7SK-(BC049762-shRNA-Seq1)(CAT#: LV-SI3930WQ)

This product is a BC049762-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of BC049762-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert BC049762-shRNA-Seq1
Related Target/Protein BC049762
Region CDS
TargetSeq CACTTTCTGTGTACCCTCAAA
NCBI RefSeq NM_177567
Alternative Names 4930503F14
Titer >1*10^10 GC/mL
Target Gene
Gene ID 193286
Uniprot ID A0A338P6D5

Related Products