shRNA Lentivirus (self-inactivating), p7SK-(BC049762-shRNA-Seq1)(CAT#: LV-SI3930WQ)
This product is a BC049762-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of BC049762-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | BC049762-shRNA-Seq1 |
Related Target/Protein | BC049762 |
Region | CDS |
TargetSeq | CACTTTCTGTGTACCCTCAAA |
NCBI RefSeq | NM_177567 |
Alternative Names | 4930503F14 |
Titer | >1*10^10 GC/mL |
Target Gene | |
---|---|
Gene ID | 193286 |
Uniprot ID | A0A338P6D5 |