shRNA Lentivirus (self-inactivating), p7SK-(C12orf32-shRNA-Seq2)(CAT#: LV-SI1401WQ)
This product is a C12orf32-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C12orf32 gene plays a role in DNA damage response (DDR) signaling upon genotoxic stresses such as ionizing radiation (IR) during the S phase. The expression of C12orf32-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | C12orf32-shRNA-Seq2 |
Related Target/Protein | C12orf32 |
Region | CDS |
TargetSeq | CCCGAGGACAAGTATGGAATA |
NCBI RefSeq | NM_031465 |
Alternative Names | RHINO; RHNO1; HKMT1188 |
Titer | >1*10^10 GC/mL |
Related Diseases | DNA damage response (DDR) |