shRNA Lentivirus (self-inactivating), p7SK-(C3orf37-shRNA-Seq1)(CAT#: LV-SI1407WQ)
This product is a C3orf37-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C3orf37 gene acts as an enzyme that recognizes and binds abasic sites in ssDNA at replication forks and chemically modifies the lesion by forming a covalent cross-link with DNA. The expression of C3orf37-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | C3orf37-shRNA-Seq1 |
Related Target/Protein | C3orf37 |
Region | CDS |
TargetSeq | CTACCAACTGTCGTAGTGATA |
NCBI RefSeq | NM_020187 |
Alternative Names | DC12; SRAPD1; HMCES |
Titer | >1*10^10 GC/mL |
Related Diseases | DNA demethylation |