shRNA Lentivirus (self-inactivating), pU6-(WDR62-shRNA-Seq1)(CAT#: LV-SI2099WQ)
This product is a WDR62-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The WDR62 gene is proposed to play a role in cerebral cortical development. Mutations in this gene have been associated with microencephaly, cortical malformations, and cognitive disability. The expression of WDR62-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | WDR62-shRNA-Seq1 |
Related Target/Protein | WDR62 |
Region | CDS |
TargetSeq | CAACTGCATGAAGCAGCACTT |
NCBI RefSeq | NM_173636 |
Alternative Names | MCPH2; C19orf14 |
Titer | >1*10^10 GC/mL |
Related Diseases | Microencephaly, cortical malformations, and cognitive disability |