shRNA Lentivirus (self-inactivating), p7SK-(Mrpl53-shRNA-Seq2)(CAT#: LV-SI3576WQ)

This product is a Mrpl53-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Mrpl53 gene may help in protein synthesis within the mitochondrion. The expression of Mrpl53-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Mrpl53-shRNA-Seq2
Related Target/Protein Mrpl53
Region CDS
TargetSeq CAACCTCAACTGCTCTGTGAT
NCBI RefSeq NM_026744
Alternative Names L53MT
Titer >1*10^10 GC/mL
Target Gene
Gene ID 116540
Uniprot ID Q96EL3

Related Products