shRNA Lentivirus (self-inactivating), p7SK-(Mrpl53-shRNA-Seq2)(CAT#: LV-SI3576WQ)
This product is a Mrpl53-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Mrpl53 gene may help in protein synthesis within the mitochondrion. The expression of Mrpl53-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Mrpl53-shRNA-Seq2 |
Related Target/Protein | Mrpl53 |
Region | CDS |
TargetSeq | CAACCTCAACTGCTCTGTGAT |
NCBI RefSeq | NM_026744 |
Alternative Names | L53MT |
Titer | >1*10^10 GC/mL |