shRNA Lentivirus (self-inactivating), p7SK-(C5orf13-shRNA-Seq2)(CAT#: LV-SI1459WQ)

This product is a C5orf13-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C5orf13 gene may have roles in neural function and cellular differentiation. The expression of C5orf13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C5orf13-shRNA-Seq2
Related Target/Protein C5orf13
Region CDS
TargetSeq CAAGAACCATTTCCAAACAAG
NCBI RefSeq NM_004772
Alternative Names P311; PTZ17; SEZ17; D4S114; NREP; PRO1873
Titer >1*10^10 GC/mL
Related Diseases Breast Cancer
Target Gene
Gene ID 9315
Uniprot ID Q16612

Related Products