shRNA Lentivirus (self-inactivating), p7SK-(CREG2-shRNA-Seq1)(CAT#: LV-SI1235WQ)

Datasheet

This product is a CREG2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Human and mouse CREG2 are putative secreted glycoproteins and may be novel neuronal extracellular molecules. The expression of CREG2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CREG2-shRNA-Seq1
Related Target/Protein CREG2
Region CDS
TargetSeq CAGTATTTCAAGGGAGGAATA
NCBI RefSeq NM_153836
Titer >1*10^10 GC/mL
Related Diseases Brain disease
Target Gene
Gene ID 200407
Uniprot ID Q8IUH2

Related Products

Recombinant lentivirus, pU6-(Rattus MYADM 3'UTR), Overexpression (CAT#:Lenti-GTOH0504WQ) shRNA Lentivirus (self-inactivating), pH1-(Vmn1r85-shRNA-Seq2) (CAT#:LV-SI2840WQ) Recombinant lentivirus, pU6-(Human hsa-mir-424), Overexpression (CAT#:Lenti-GTOH0388WQ) shRNA Lentivirus (self-inactivating), pU6-(C4orf37-shRNA-Seq1) (CAT#:LV-SI0332WQ) shRNA Lentivirus (self-inactivating), p7SK-(Tmem231-shRNA-Seq2) (CAT#:LV-SI3523WQ) shRNA Lentivirus (self-inactivating), p7SK-(Lsm14a-shRNA-Seq3) (CAT#:LV-SI3480WQ) shRNA Lentivirus (self-inactivating), pU6-(C8orf44-shRNA-Seq2) (CAT#:LV-SI1518WQ) Recombinant lentivirus, pU6-(Mouse HCN4 3'UTR), Overexpression (CAT#:Lenti-GTOH0045WQ)