shRNA Lentivirus (self-inactivating), p7SK-(CCDC11-shRNA-Seq3)(CAT#: LV-SI1486WQ)
This product is a CCDC11-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CCDC11 gene belongs to the CFAP53 family. It was found to be differentially expressed by the ciliated cells of frog epidermis and in skin fibroblasts from human. The expression of CCDC11-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | CCDC11-shRNA-Seq3 |
| Related Target/Protein | CCDC11 |
| Region | 3UTR |
| TargetSeq | CCGTGAGCATCAATATATCTT |
| NCBI RefSeq | NM_145020 |
| Alternative Names | HTX6; CFAP53 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Visceral heterotaxy-6 |
