shRNA Lentivirus (self-inactivating), p7SK-(CCT3-shRNA-Seq2)(CAT#: LV-SI3803WQ)

This product is a CCT3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by CCT3 gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). The expression of CCT3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CCT3-shRNA-Seq2
Related Target/Protein CCT3
Region CDS
TargetSeq CCATGACTGGTGTGGAACAAT
NCBI RefSeq NM_005998
Alternative Names CCTG; PIG48; TRIC5; CCT-gamma; TCP-1-gamma
Titer >1*10^10 GC/mL
Target Gene
Gene ID 7203
Uniprot ID P49368

Related Products