shRNA Lentivirus (self-inactivating), p7SK-(Csprs-shRNA-Seq1)(CAT#: LV-SI3708WQ)
This product is a Csprs-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Csprs-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Csprs-shRNA-Seq1 |
| Related Target/Protein | Csprs |
| Region | CDS |
| TargetSeq | CCATTGTCATTATCGCAATAG |
| NCBI RefSeq | NM_033616 |
| Alternative Names | HSR; D1Lub1 |
| Titer | >1*10^10 GC/mL |
