shRNA Lentivirus (self-inactivating), p7SK-(Eif2b1-shRNA-Seq2)(CAT#: LV-SI3612WQ)
This product is a Eif2b1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Eif2b1 gene encodes one of five subunits of eukaryotic translation initiation factor 2B (EIF2B), a GTP exchange factor for eukaryotic initiation factor 2 and an essential regulator for protein synthesis. Mutations in this gene and the genes encoding other EIF2B subunits have been associated with leukoencephalopathy with vanishing white matter. The expression of Eif2b1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Eif2b1-shRNA-Seq2 |
Related Target/Protein | Eif2b1 |
Region | CDS |
TargetSeq | CAAATCTCACCTATGCCATAA |
NCBI RefSeq | NM_145371 |
Alternative Names | EIF2B; EIF2BA |
Titer | >1*10^10 GC/mL |
Related Diseases | Leukoencephalopathy |