shRNA Lentivirus (self-inactivating), p7SK-(ENSMUSG00000063277-shRNA-Seq6)(CAT#: LV-SI3900WQ)

This product is a ENSMUSG00000063277-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of ENSMUSG00000063277-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert ENSMUSG00000063277-shRNA-Seq6
Related Target/Protein ENSMUSG00000063277
Region CDS
TargetSeq CCAAGGAACAGCAGTGTGATA
NCBI RefSeq NM_025940
Alternative Names Gm10128
Titer >1*10^10 GC/mL
Target Gene
Gene ID 100042312
Uniprot ID K7N708

Related Products