shRNA Lentivirus (self-inactivating), pH1-(CLMP-shRNA-Seq3)(CAT#: LV-SI0600WQ)
This product is a CLMP-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CLMP gene encodes a type I transmembrane protein that is localized to junctional complexes between endothelial and epithelial cells and may have a role in cell-cell adhesion. The expression of CLMP-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | CLMP-shRNA-Seq3 |
Related Target/Protein | CLMP |
Region | CDS |
TargetSeq | CCTTGCAGATTGAACCTCTGA |
NCBI RefSeq | NM_024769 |
Alternative Names | ACAM; ASAM; CSBM; CSBS |
Titer | >1*10^10 GC/mL |
Related Diseases | Congenital short bowel syndrome |