shRNA Lentivirus (self-inactivating), p7SK-(Rtn4ip1-shRNA-Seq1)(CAT#: LV-SI3952WQ)
This product is a Rtn4ip1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Rtn4ip1 gene encodes a mitochondrial protein that interacts with reticulon 4, which is a potent inhibitor of regeneration following spinal cord injury. The expression of Rtn4ip1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Rtn4ip1-shRNA-Seq1 |
Related Target/Protein | Rtn4ip1 |
Region | CDS |
TargetSeq | GAACATGATGTTACCTATCAT |
NCBI RefSeq | NM_130892 |
Alternative Names | NIMP; OPA10 |
Titer | >1*10^10 GC/mL |
Related Diseases | Optic atrophy |