shRNA Lentivirus (self-inactivating), p7SK-(GLOD4-shRNA-Seq2)(CAT#: LV-SI1145WQ)

Datasheet

This product is a GLOD4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Transfection of GLOD4 gene in hepatocellular carcinoma cells and overexpression can inhibit the cell growth. The expression of GLOD4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert GLOD4-shRNA-Seq2
Related Target/Protein GLOD4
Region 3UTR
TargetSeq CGAGCTTCTTTCTGTGTATAT
NCBI RefSeq NM_016080
Alternative Names HC71; CGI-150; C17orf25
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular carcinoma
Target Gene
Gene ID 51031
Uniprot ID Q9HC38

Related Products

Recombinant lentivirus, pU6-(Human hsa-miR-514b-3p), Overexpression (CAT#:Lenti-GTOH0503WQ) shRNA Lentivirus (self-inactivating), pH1-(CLMP-shRNA-Seq3) (CAT#:LV-SI0600WQ) shRNA Lentivirus (self-inactivating), pH1-(Eif2b1-shRNA-Seq5) (CAT#:LV-SI2765WQ) shRNA Lentivirus (self-inactivating), pU6-(OR5B12-shRNA-Seq1) (CAT#:LV-SI1649WQ) shRNA Lentivirus (self-inactivating), pH1-(OR1L3-shRNA-Seq1) (CAT#:LV-SI2426WQ) shRNA Lentivirus (self-inactivating), pU6-(WBP2NL-shRNA-Seq1) (CAT#:LV-SI1905WQ) shRNA Lentivirus (self-inactivating), pU6-(ZNF280C-shRNA-Seq2) (CAT#:LV-SI0444WQ) shRNA Lentivirus (self-inactivating), pU6-(4933409G03Rik-shRNA-Seq4) (CAT#:LV-SI1796WQ)