shRNA Lentivirus (self-inactivating), p7SK-(Hsp7SK-shRNA-Seq4)(CAT#: LV-SI3668WQ)
This product is a Hsph1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Hsph1 gene encodes a member of the heat shock protein 70 family of proteins and functions as a nucleotide exchange factor for the molecular chaperone heat shock cognate 71 kDa protein (Hsc70). The expression of Hsph1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Hsph1-shRNA-Seq4 |
Related Target/Protein | Hsph1 |
Region | CDS |
TargetSeq | GAGATTTCATGGCAGAGCATT |
NCBI RefSeq | NM_013559 |
Alternative Names | HSP105; HSP105A; HSP105B; NY-CO-25 |
Titer | >1*10^10 GC/mL |
Related Diseases | Cancer |