shRNA Lentivirus (self-inactivating), pH1-(C4orf41-shRNA-Seq1)(CAT#: LV-SI0742WQ)
This product is a C4orf41-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by C4orf41 gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. The expression of C4orf41-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | C4orf41-shRNA-Seq1 |
| Related Target/Protein | C4orf41 |
| Region | CDS |
| TargetSeq | GCTGCCATCTCTCAACATCAA |
| NCBI RefSeq | NM_021942 |
| Alternative Names | GRY; FOIGR; LGMD2S; TRAPPC11; LGMDR18 |
| Titer | >1*10^10 GC/mL |
