shRNA Lentivirus (self-inactivating), p7SK-(Ktn1-shRNA-Seq5)(CAT#: LV-SI3449WQ)

This product is a Ktn1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Ktn1 gene encodes an integral membrane protein that is a member of the kinectin protein family. The expression of Ktn1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Ktn1-shRNA-Seq5
Related Target/Protein Ktn1
Region CDS
TargetSeq GCAGAAACTTCCAGTAGTGTT
NCBI RefSeq NM_008477
Alternative Names CG1; KNT; MU-RMS-40.19
Titer >1*10^10 GC/mL
Target Gene
Gene ID 3895
Uniprot ID Q86UP2

Related Products