shRNA Lentivirus (self-inactivating), p7SK-(MAP6D1-shRNA-Seq3)(CAT#: LV-SI1201WQ)

This product is a MAP6D1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The MAP6D1 gene encodes a protein highly similar to the mouse MAP6 domain containing 1 protein, which is related to the STOP proteins. The expression of MAP6D1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert MAP6D1-shRNA-Seq3
Related Target/Protein MAP6D1
Region 3UTR
TargetSeq GCTGAGTATCCAGGAGGAAAT
NCBI RefSeq NM_024871
Alternative Names SL21; MAPO6D1
Titer >1*10^10 GC/mL
Related Diseases Renal cancer
Target Gene
Gene ID 79929
Uniprot ID Q9H9H5

Related Products