shRNA Lentivirus (self-inactivating), pH1-(Arl10-shRNA-Seq1)(CAT#: LV-SI3098WQ)

This product is a Arl10-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Arl10-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Arl10-shRNA-Seq1
Related Target/Protein Arl10
Region CDS
TargetSeq CTTTATCCTCTGGAAAGCTTA
NCBI RefSeq NM_019968
Alternative Names ARL10A
Titer >1*10^10 GC/mL
Related Diseases Chromosome segregation
Target Gene
Gene ID 285598
Uniprot ID Q8N8L6

Related Products