shRNA Lentivirus (self-inactivating), pH1-(Hspa4-shRNA-Seq1)(CAT#: LV-SI2790WQ)

This product is a Hspa4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Hspa4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Hspa4-shRNA-Seq1
Related Target/Protein Hspa4
Region CDS
TargetSeq CCACTGGATTAACGGGCATAA
NCBI RefSeq NM_008300
Alternative Names RY; APG-2; HSPH2; hsp70; hsp70RY; HEL-S-5a; HS24/P52
Titer >1*10^10 GC/mL
Target Gene
Gene ID 3308
Uniprot ID P34932

Related Products