shRNA Lentivirus (self-inactivating), p7SK-(PCOLCE-shRNA-Seq1)(CAT#: LV-SI1405WQ)

This product is a PCOLCE-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The PCOLCE gene encodes a glycoprotein which binds and drives the enzymatic cleavage of type I procollagen and heightens C-proteinase activity. The expression of PCOLCE-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert PCOLCE-shRNA-Seq1
Related Target/Protein PCOLCE
Region CDS
TargetSeq GAATGAACTCCTCGTCCAGTT
NCBI RefSeq NM_002593
Alternative Names PCPE; PCPE1; PCPE-1
Titer >1*10^10 GC/mL
Related Diseases Psoriatic arthritis
Target Gene
Gene ID 5118
Uniprot ID Q15113

Related Products