shRNA Lentivirus (self-inactivating), pU6-(MICALCL-shRNA-Seq2)(CAT#: LV-SI0085WQ)
This product is a MICALCL-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The MICALCL gene may cooperate with MAPK1/ERK2 via an intracellular signal transduction pathway in the morphogenetic development of round spermatids to spermatozoa and act as Rab effector protein and play a role in vesicle trafficking. The expression of MICALCL-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | MICALCL-shRNA-Seq2 |
Related Target/Protein | MICALCL |
Region | CDS |
TargetSeq | CAAAGCAGACTGGAGCAGAAA |
NCBI RefSeq | NM_032867 |
Alternative Names | Ebitein1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Renal cancer |