shRNA Lentivirus (self-inactivating), p7SK-(PRM2-shRNA-Seq2)(CAT#: LV-SI1398WQ)

This product is a PRM2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The PRM2 gene encodes protamine 2, which is cleaved to give rise to a family of protamine 2 peptides. The expression of PRM2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert PRM2-shRNA-Seq2
Related Target/Protein PRM2
Region CDS
TargetSeq GAACCAGGAAGAGAACATGCA
NCBI RefSeq NM_002762
Alternative Names CT94.2
Titer >1*10^10 GC/mL
Related Diseases Prostate cancer
Target Gene
Gene ID 5620
Uniprot ID P04554

Related Products