shRNA Lentivirus (self-inactivating), pH1-(PCOLCE-shRNA-Seq2)(CAT#: LV-SI0905WQ)
This product is a PCOLCE-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The PCOLCE gene encodes a glycoprotein which binds and drives the enzymatic cleavage of type I procollagen and heightens C-proteinase activity. The expression of PCOLCE-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | PCOLCE-shRNA-Seq2 |
Related Target/Protein | PCOLCE |
Region | CDS |
TargetSeq | CCATGAAGAAAGGAGTCAGTT |
NCBI RefSeq | NM_002593 |
Alternative Names | PCPE; PCPE1; PCPE-1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Psoriatic arthritis |