shRNA Lentivirus (self-inactivating), p7SK-(SDHAF2-shRNA-Seq2)(CAT#: LV-SI1480WQ)

This product is a SDHAF2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SDHAF2 gene encodes a mitochondrial protein needed for the flavination of a succinate dehydrogenase complex subunit required for activity of the complex. The expression of SDHAF2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SDHAF2-shRNA-Seq2
Related Target/Protein SDHAF2
Region CDS
TargetSeq CCTGCTCTATGAGAGCAGAAA
NCBI RefSeq NM_017841
Alternative Names PGL2; SDH5; C11orf79
Titer >1*10^10 GC/mL
Related Diseases Paraganglioma
Target Gene
Gene ID 54949
Uniprot ID Q9NX18

Related Products