shRNA Lentivirus (self-inactivating), pH1-(Cenpc1-shRNA-Seq5)(CAT#: LV-SI2593WQ)

This product is a Cenpc1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Cenpc1 gene is a centromere autoantigen and a component of the inner kinetochore plate. The encoded protein is required for maintaining proper kinetochore size and a timely transition to anaphase. The expression of Cenpc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Cenpc1-shRNA-Seq5
Related Target/Protein Cenpc1
Region 3UTR
TargetSeq GTTAATCATTTCGTACTCCTT
NCBI RefSeq NM_007683
Alternative Names MIF2; hcp-4; CENP-C; CENPC
Titer >1*10^10 GC/mL
Target Gene
Gene ID 1060
Uniprot ID Q03188

Related Products