shRNA Lentivirus (self-inactivating), p7SK-(SESTD1-shRNA-Seq2)(CAT#: LV-SI1286WQ)
This product is a SESTD1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SESTD1 gene may act as the primary docking protein directing membrane turnover and assembly of the transient receptor potential channels TRPC4 and TRPC5. The expression of SESTD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | SESTD1-shRNA-Seq2 |
Related Target/Protein | SESTD1 |
Region | CDS |
TargetSeq | GCTGAGTGTCACCTTAGACTT |
NCBI RefSeq | NM_178123 |
Alternative Names | SOLO |
Titer | >1*10^10 GC/mL |
Related Diseases | Lithium-responsive bipolar disorder |