shRNA Lentivirus (self-inactivating), p7SK-(WDR62-shRNA-Seq2)(CAT#: LV-SI3800WQ)
This product is a WDR62-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The WDR62 gene is proposed to play a role in cerebral cortical development. Mutations in this gene have been associated with microencephaly, cortical malformations, and cognitive disability. The expression of WDR62-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | WDR62-shRNA-Seq2 |
| Related Target/Protein | WDR62 |
| Region | CDS |
| TargetSeq | CAACACCATTCGCTTCTGGAA |
| NCBI RefSeq | NM_173636 |
| Alternative Names | MCPH2; C19orf14 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Microencephaly, cortical malformations, and cognitive disability |
