shRNA Lentivirus (self-inactivating), pH1-(CTTNBP2NL-shRNA-Seq3)(CAT#: LV-SI0796WQ)
This product is a CTTNBP2NL-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of CTTNBP2NL-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | CTTNBP2NL-shRNA-Seq3 |
Related Target/Protein | CTTNBP2NL |
Region | 3UTR |
TargetSeq | CGTTTGACATTCCATCAGATT |
NCBI RefSeq | NM_018704 |
Alternative Names | KIAA1433 |
Titer | >1*10^10 GC/mL |