shRNA Lentivirus (self-inactivating), pH1-(Fam166a-shRNA-Seq3)(CAT#: LV-SI2584WQ)

This product is a Fam166a-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Fam166a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Fam166a-shRNA-Seq3
Related Target/Protein Fam166a
Region CDS
TargetSeq CACACAAGCTATGGATGACTT
NCBI RefSeq NM_026624
Alternative Names HSD46
Titer >1*10^10 GC/mL
Target Gene
Gene ID 401565
Uniprot ID Q6J272

Related Products