shRNA Lentivirus (self-inactivating), pH1-(FAM36A-shRNA-Seq2)(CAT#: LV-SI1000WQ)

This product is a FAM36A-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The FAM36A gene encodes a protein that plays a role in the assembly of cytochrome C oxidase, an important component of the respiratory pathway. The expression of FAM36A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert FAM36A-shRNA-Seq2
Related Target/Protein FAM36A
Region CDS
TargetSeq CAAAGCAAAGAATCCAGGAAA
NCBI RefSeq NM_198076
Alternative Names COX20
Titer >1*10^10 GC/mL
Related Diseases Mitochondrial complex IV deficiency
Target Gene
Gene ID 116228
Uniprot ID Q5RI15

Related Products