shRNA Lentivirus (self-inactivating), pH1-(GOLGA3-shRNA-Seq1)(CAT#: LV-SI2705WQ)

This product is a GOLGA3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The GOLGA3 gene participates in glycosylation and transport of proteins and lipids in the secretory pathway. The expression of GOLGA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert GOLGA3-shRNA-Seq1
Related Target/Protein GOLGA3
Region 3UTR
TargetSeq CCAGAGTTACTTCAGTGCATA
NCBI RefSeq NM_005895
Alternative Names MEA-2; GCP170
Titer >1*10^10 GC/mL
Target Gene
Gene ID 2802
Uniprot ID Q08378

Related Products